Journal: Cell Death and Differentiation

Article Title: Enhanced PAPSS2/VCAN sulfation axis is essential for Snail-mediated breast cancer cell migration and metastasis

doi: 10.1038/s41418-018-0147-y

Figure Lengend Snippet: Snail activates the transcription of PAPSS2 in breast cancer cells. a The Volcano Plot analysis of the differentially expressed genes in MCF 10A-Snail and -vector cells identified by the RNA-seq approach. Red dots represent genes induced by Snail, green dots represent genes repressed by Snail, and blue dots represent genes without significant difference. b Heat map showed the representatives of differentially expressed genes regulated by Snail expression in MCF 10A cells. c qRT-PCR validation of the known Snail target genes in MCF 10A cells. Data were shown as mean ± S.D. from three independent experiments. **P < 0.001, ***P < 0.0001, compared with Vector group. d–f Overexpression of Snail increased PAPSS2 mRNA level in MCF 10A cells (d), MCF7 cells (e), and MDA-MB-231 cells (f). Data were shown as mean ± S.D. from three independent experiments. ***P < 0.0001, **P < 0.001, *P < 0.05, compared with vector group (left panels). Western blots showed the protein levels of Snail and PAPSS2 (right panels). g Human PAPSS2 promoter-luc reporter activity was induced by Snail in 293T cells. Human PAPSS2 gene promoter (−138 +138) was subcloned into pGL3 basic luciferase vector to create a PAPSS2-Luc reporter (upper panel). Assays were performed in 293T cells and the luciferase activity was normalized to β-galactosidase activity. Error bars show standard deviations (bottom panel). h Snail bound to the proximal promoter region of PAPSS2. The ChIP assays were performed in MDA-MB-231 (middle panel) and MCF 10A-Snail cells (right panel) with specific antibody against Snail and the enriched DNA fragments were examined by qPCR. Error bars show standard deviations. **P < 0.001, *P < 0.05

Article Snippet: The plasmids of PLKO.1-shPAPSS2 and shVCAN were obtained from GE-Lifescience and the short hairpin RNA sequences are listed in Table . table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequences Sense sequences in shRNA PAPSS2 shRNA-1 TTTGGCTTTGTTGTAGGCAGC PAPSS2 shRNA-2 AATCCGAGATTTCTGTTAAGG VCAN shRNA-1 AATACTCTCTATCAATATCGG VCAN shRNA-2 ATCTTAGACCATTTGATGCGG Primers for ChIP PAPSS2-set1-Forward GCCTTTTGGTGATAGGGTCA PAPSS2-set1-Reverse GGGCTGCATGAGGTATTCAC PAPSS2-set2-Forward GTGGCGGGAGGAGGAGTAG PAPSS2-set2-Reverse CTCCCGGGAAGGAGGTATAA VCAN- Forward AGAGCGATGTTACTGAGTG VCAN-Reverse GGTTCATTCACAGGCTCC Primers for qRT-PCR Snail-84-Forward TTTACCTTCCAGCAGCCCTA Snail-291-Reverse CCCACTGTCCTCATCTGACA PAPSS2-1488-Forward CAGTTGCGCAATCCTGTCCACAAT PAPSS2-1785-Reverse AGAAATTGGCACCCGCAATCATCC VCAN-947-Forward GAGGTGGTCTACTTGGGGTGA VCAN-1203-Reverse ACAAGTGGCTCCATTACGAC Open in a separate window Primer list Cell culture and luciferase reporter assay The human breast cell lines MCF 10A, MCF7, and MDA-MB-231 were originally obtained from the American Type Culture Collection (ATCC) and were authenticated by DNA fingerprinting in our lab. MCF7, MDA-MB-231, and 293T were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS, 2 mM L-glutamine and penicillin (50 U/ml)/streptomycin (50 μg/ml) at 37 ℃ under 5% CO 2 in a humidified chamber.

Techniques: Plasmid Preparation, RNA Sequencing Assay, Expressing, Quantitative RT-PCR, Over Expression, Western Blot, Activity Assay, Luciferase

Journal: Cell Death and Differentiation

Article Title: Enhanced PAPSS2/VCAN sulfation axis is essential for Snail-mediated breast cancer cell migration and metastasis

doi: 10.1038/s41418-018-0147-y

Figure Lengend Snippet: PAPSS2 is required for breast cancer cell migration and metastasis. a, e Protein levels of PAPSS2 were quantified by immunoblot analysis in MDA-MB-231 cells with PAPSS2 knocking-down (a) and overexpression (e), respectively. b Transwell assay shows migration abilities of MDA-MB-231-shPAPSS2 cells. Left panel: representative images of migrated cells; right panel: statistical analysis of the average number of migrated cells from the nine randomly chosen fields. Data were shown as mean ± S.D. from three independent experiments. *P < 0.05, compared with Vector groups, 100×, scale bar, 200 μm. c Knocking-down of PAPSS2 in MDA-MB-231 cells inhibited lung metastasis in vivo. Left panel: intensities of lung metastasis in mice at the 6th week were analyzed by in-vivo imaging. Right panel: quantification of lung photon flux at the 2nd, 4th, and 6th week. P value was determined using Student’s t-test, *P < 0.05,**P < 0.001, compared with vector group (n = 7 and n = 6, respectively). d Knocking-down of PAPSS2 decreased number of metastatic nodules on lungs. Left panel: Representative images of metastatic nodules are shown. Right panel: the average number of metastatic tumor nodules shows significant difference between the vector and PAPSS2 knocking-down group. Data were shown as mean ± S.D. ***P < 0.0001, compared with vector group. f–h Migration and invasion capabilities were elevated in PAPSS2-overexpressed MDA-MB-231 cells. f Representative images of invading and migrating cells, 100×, scale bar, 200 μm. g Statistic analysis of migrating cell number, ***P < 0.0001. h Statistic analysis of invasion percentage, % Invasion = (mean number of cell invading through Matrigel Matrix coated membrane/mean number of cells migrating through uncoated membrane) x 100. ***P < 0.0001. i Overexpression of PAPSS2 in MDA-MB-231 cells promoted lung metastasis in vivo. Left panel: intensities of lung metastasis in mice at the 4th week were analyzed by in-vivo imaging. Right panel: quantification of lung photon flux at the 0th, 2nd, 4th and 6th week. P value was determined using Student’s t-test, **P < 0.001, compared with vector group (n = 10)

Article Snippet: The plasmids of PLKO.1-shPAPSS2 and shVCAN were obtained from GE-Lifescience and the short hairpin RNA sequences are listed in Table . table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequences Sense sequences in shRNA PAPSS2 shRNA-1 TTTGGCTTTGTTGTAGGCAGC PAPSS2 shRNA-2 AATCCGAGATTTCTGTTAAGG VCAN shRNA-1 AATACTCTCTATCAATATCGG VCAN shRNA-2 ATCTTAGACCATTTGATGCGG Primers for ChIP PAPSS2-set1-Forward GCCTTTTGGTGATAGGGTCA PAPSS2-set1-Reverse GGGCTGCATGAGGTATTCAC PAPSS2-set2-Forward GTGGCGGGAGGAGGAGTAG PAPSS2-set2-Reverse CTCCCGGGAAGGAGGTATAA VCAN- Forward AGAGCGATGTTACTGAGTG VCAN-Reverse GGTTCATTCACAGGCTCC Primers for qRT-PCR Snail-84-Forward TTTACCTTCCAGCAGCCCTA Snail-291-Reverse CCCACTGTCCTCATCTGACA PAPSS2-1488-Forward CAGTTGCGCAATCCTGTCCACAAT PAPSS2-1785-Reverse AGAAATTGGCACCCGCAATCATCC VCAN-947-Forward GAGGTGGTCTACTTGGGGTGA VCAN-1203-Reverse ACAAGTGGCTCCATTACGAC Open in a separate window Primer list Cell culture and luciferase reporter assay The human breast cell lines MCF 10A, MCF7, and MDA-MB-231 were originally obtained from the American Type Culture Collection (ATCC) and were authenticated by DNA fingerprinting in our lab. MCF7, MDA-MB-231, and 293T were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS, 2 mM L-glutamine and penicillin (50 U/ml)/streptomycin (50 μg/ml) at 37 ℃ under 5% CO 2 in a humidified chamber.

Techniques: Migration, Western Blot, Over Expression, Transwell Assay, Plasmid Preparation, In Vivo, In Vivo Imaging

Journal: Cell Death and Differentiation

Article Title: Enhanced PAPSS2/VCAN sulfation axis is essential for Snail-mediated breast cancer cell migration and metastasis

doi: 10.1038/s41418-018-0147-y

Figure Lengend Snippet: Snail activates transcription of VCAN and increases sulfation of Versican. a, b Real-time PCR analysis showed increased transcription levels of VCAN in Snail-overexpressed MDA-MB-231 (a) and MCF7 cells lines (b), *P < 0.05, ***P < 0.0001, compared with the vector groups. c Upper: diagram illustrates the human VCAN promoter and the PCR primers used for ChIP. Bottom: examination of the enriched DNA fragments by the ChIP assays using qPCR in MDA-MB-231 cells. Error bars show standard deviations, IgG immunoglobulin. d Snail increased the expression of Versican in MCF 10A cells. Left panel: indirect immunofluorescent assays were performed to examine the subcellular localization of Versican in Snail-overexpressed MCF 10A and MCF 10A-Vector cell lines. Right panel: Average intensity of Versican on every cell in six fields chosen randomly was measured, ***P < 0.0001, compared to the vector group. The average number of cells located in every vision was counted, No = 24/Flag-vector; No = 13/Flag-Snail. e Western blots showed that expression levels of Versican in cell lysate and extracellular matrix, as well as sulfation level in Snail-overexpressed MCF 10A cells. ch-ABC chondroitinase ABC. f Western blots showed that expression levels of Versican in cell lysate and extracellular matrix, as well as sulfation level in PAPSS2-overexpressed MCF 10A cells. Note: Ponceau staining is used as loading control for proteins collected from media

Article Snippet: The plasmids of PLKO.1-shPAPSS2 and shVCAN were obtained from GE-Lifescience and the short hairpin RNA sequences are listed in Table . table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Primers Sequences Sense sequences in shRNA PAPSS2 shRNA-1 TTTGGCTTTGTTGTAGGCAGC PAPSS2 shRNA-2 AATCCGAGATTTCTGTTAAGG VCAN shRNA-1 AATACTCTCTATCAATATCGG VCAN shRNA-2 ATCTTAGACCATTTGATGCGG Primers for ChIP PAPSS2-set1-Forward GCCTTTTGGTGATAGGGTCA PAPSS2-set1-Reverse GGGCTGCATGAGGTATTCAC PAPSS2-set2-Forward GTGGCGGGAGGAGGAGTAG PAPSS2-set2-Reverse CTCCCGGGAAGGAGGTATAA VCAN- Forward AGAGCGATGTTACTGAGTG VCAN-Reverse GGTTCATTCACAGGCTCC Primers for qRT-PCR Snail-84-Forward TTTACCTTCCAGCAGCCCTA Snail-291-Reverse CCCACTGTCCTCATCTGACA PAPSS2-1488-Forward CAGTTGCGCAATCCTGTCCACAAT PAPSS2-1785-Reverse AGAAATTGGCACCCGCAATCATCC VCAN-947-Forward GAGGTGGTCTACTTGGGGTGA VCAN-1203-Reverse ACAAGTGGCTCCATTACGAC Open in a separate window Primer list Cell culture and luciferase reporter assay The human breast cell lines MCF 10A, MCF7, and MDA-MB-231 were originally obtained from the American Type Culture Collection (ATCC) and were authenticated by DNA fingerprinting in our lab. MCF7, MDA-MB-231, and 293T were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS, 2 mM L-glutamine and penicillin (50 U/ml)/streptomycin (50 μg/ml) at 37 ℃ under 5% CO 2 in a humidified chamber.

Techniques: Real-time Polymerase Chain Reaction, Plasmid Preparation, Expressing, Western Blot, Staining